compare_deletion_with_reference.txt 3.44 KB
Newer Older
Rebecca E Batorsky's avatar
Rebecca E Batorsky committed
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
original reference has flanking sequence:
before = ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAG
after =  AGGCAGATCGGAAGAGCACACGTCTGAACTCCAGTC

rest of reference:
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG

before break:
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT

after break:
CCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG



#gap deletions
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT----------GGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT------------------------------CTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACAT-----------CCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCT--TATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (is labeled complex line 3 in test)

Rebecca E Batorsky's avatar
Rebecca E Batorsky committed
22
For Python progr
Rebecca E Batorsky's avatar
Rebecca E Batorsky committed
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47

#nogap deletions
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG  (is labeled complex line 3 in test)

#insertions
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG ( is labeled complex line 9 in test)


# understand complex sequences

# insertion
70M4D4I97M
G>A
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG #ref
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG #complex

#deletion
70M4D2I97M
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
Rebecca E Batorsky's avatar
Rebecca E Batorsky committed
48
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCT--TATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG