Commit 1efb23d3 authored by Rebecca E Batorsky's avatar Rebecca E Batorsky
Browse files

cleaning out test files

parent 506de0df
......@@ -28,13 +28,9 @@ if (length(args)<5) {
}
# hifi_in = "~/Documents/git/sdmmej/test_data/polyA1Seq/PolyA1Seq_testdata_output/PolyA1Seq_testdata_reclassified.csv"
# insertion_in = "~/Documents/git/sdmmej/test_data/polyA1Seq/PolyA1Seq_testdata_output/PolyA1Seq_testdata_complex.txt"
# out_dir = "~/Documents/git/sdmmej/test_data/polyA1Seq/PolyA1Seq_testdata_output/"
# nick = 161
# search_radius=30
a<-read.csv(insertion_in)
## get reference
hifibr_input = read.csv(hifi_in,header=T)
......@@ -54,18 +50,15 @@ n <- search_radius # number of bases to the left and right of the break you wan
p <- 10 # number of bases to the left and right of the initial repeat motif to search for homology
### for naming the output files
#plasmid <- "test_data_m6"
plasmid <- gsub("_reclassified.csv","",basename(hifi_in))
type <- gsub(plasmid, "", basename(insertion_in))
type <- gsub(".txt", "", type)
type <- gsub("_", "", type)
#L <- "GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT"
L = substr(ref,0,nick)
print("left of nick")
print(L)
#R <- "TTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG"
l=length(ref)
R <- substr(ref,nick+1,nchar(ref))
print("right of nick")
......@@ -73,13 +66,11 @@ print(R)
l <- nchar(L) # number of nucleotides of the left hand sequence
r <- nchar(R) # number of nucleotides of the right hand sequence
# k1 <- 30 # how far you want to cut back to search, this needs to to be adjusted based on how large the deletions are, but i think this covers up to 30 bp of deletion on either side.
# k2 <- 30
k1 <- 30 # how far you want to cut back to search, this needs to to be adjusted based on how large the deletions are, but i think this covers up to 30 bp of deletion on either side.
k2 <- 30
sL1 <- substring(L, 1, (l-k1-1):l)
print(sL1)
sR1 <- substring(R, 1:(r-k2-1),r)
a2=NULL # create empty vector to insert left del boundary
......@@ -88,7 +79,7 @@ for (i in a[, 1]){
lb <- na.omit(lb)
lbb <- lb[nrow(lb),2]
if (length(lbb) == 0){
print(paste0("No match found left of boundary for sequenc ", i))
print(paste0("No match found left of boundary for sequence ", i))
a2[i] = 0
}else{
a2[i] = lbb
......
This diff is collapsed.
RECONSTRUCTED_SEQ
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
"","ID","insertion_alignment","mechanism"
"1","PolyA1Seq_testdata-1","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","seq"
"2","PolyA1Seq_testdata-1","--------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAA----------------------------------------------------------------------------------------------------------------------------------------------------------","Loop-out"
"3","PolyA1Seq_testdata-1","0","Snap-back"
"4","PolyA1Seq_testdata-2","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","seq"
"5","PolyA1Seq_testdata-2","0","Loop-out"
"6","PolyA1Seq_testdata-2","0","Snap-back"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","RECONSTRUCTED_SEQ","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","Loop-out","Snap-back"
"1","PolyA1Seq_testdata-1",164,167,NA,143,"TRUE","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC",160,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","A","PolyA1Seq_testdata",4,3,"--------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAA----------------------------------------------------------------------------------------------------------------------------------------------------------","0"
"2","PolyA1Seq_testdata-2",NA,NA,NA,NA,"FALSE","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC",0,163,"TAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"0","0"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","mechanism","insertion_alignment","unicorn"
"1","PolyA1Seq_testdata-1",164,167,NA,143,"TRUE",160,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","A","PolyA1Seq_testdata",4,3,"seq","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","PolyA1Seq_testdata-1-seq-GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC"
"3","PolyA1Seq_testdata-1",164,167,NA,143,"TRUE",160,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","A","PolyA1Seq_testdata",4,3,"Loop-out","--------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAA----------------------------------------------------------------------------------------------------------------------------------------------------------","PolyA1Seq_testdata-1-Loop-out---------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAA----------------------------------------------------------------------------------------------------------------------------------------------------------"
"5","PolyA1Seq_testdata-1",164,167,NA,143,"TRUE",160,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","A","PolyA1Seq_testdata",4,3,"Snap-back","0","PolyA1Seq_testdata-1-Snap-back-0"
"2","PolyA1Seq_testdata-2",NA,NA,NA,NA,"FALSE",0,163,"TAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"seq","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","PolyA1Seq_testdata-2-seq-GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC"
"4","PolyA1Seq_testdata-2",NA,NA,NA,NA,"FALSE",0,163,"TAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Loop-out","0","PolyA1Seq_testdata-2-Loop-out-0"
"6","PolyA1Seq_testdata-2",NA,NA,NA,NA,"FALSE",0,163,"TAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Snap-back","0","PolyA1Seq_testdata-2-Snap-back-0"
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC---AGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTA--CCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
Sample ID Deletion Length Repair Type Mechanism Motif to Break Motif to Deletion P1 to Break P1 to Deletion P2 to Break P2 to Deletion P1 to P2 Motif Length Break Side Deletion to MH Motif Sequence
1 3 ABJ snap-back 11 11 8 8 1 1 7 4 left -3 CCTG/CAGG
1 3 ABJ loop-out 17 14 17 14 8 5 9 6 right 0 CAGGCC/CAGGCC
2 2 ABJ loop-out 27 23 27 23 5 1 22 4 left 2 ACCT/ACCT
2 2 ABJ loop-out 15 11 15 11 7 3 8 5 left 2 TTACC/TTACC
RECONSTRUCTED_SEQ
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
"","ID","insertion_alignment","mechanism"
"1","PolyA1Seq_testdata-1","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","seq"
"2","PolyA1Seq_testdata-1","0","Loop-out"
"3","PolyA1Seq_testdata-1","0","Snap-back"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","RECONSTRUCTED_SEQ","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","Loop-out","Snap-back"
"1","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"0","0"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","mechanism","insertion_alignment","unicorn"
"1","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"seq","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","PolyA1Seq_testdata-1-seq-GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC"
"2","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Loop-out","0","PolyA1Seq_testdata-1-Loop-out-0"
"3","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Snap-back","0","PolyA1Seq_testdata-1-Snap-back-0"
ID,UMI,CIGAR_STRING,READ_LENGTH,SPLIT_CIGAR_STRING,MATCH_LEFT,MATCH_RIGHT,DISTANCE_FROM_BREAK_LEFT,DISTANCE_FROM_BREAK_RIGHT,DELETION_FROM_LEFT,DELETION_FROM_RIGHT,TOTAL_DELETION,INSERTION_START,INSERTION_END,INSERTION_LENGTH,INSERTED_SEQ,CLASS,ALIGNED_SEQ,READS,MICROHOMOLOGY,MH_Length,NUMBER_OF_ALIGNMENTS,MISMATCH_PERCENTAGE_TO_RECONSTRUCTED,CLASS_final
1,AATTGGAAAA_CTCATGTCCT,325M,325,325M,325,325,164,161,0,0,0,161,164,0,,exact,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,214208,NA,NA,1,1.847269943,exact
2,AATTGGAAAA_CTCATGTCCT,325M,325,325M,150,164,-11,0,-11,0,-11,150,164,11,NCTGTTATCCC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,24,NA,NA,1,8.333333333,insertion
3,AATTGGAAAA_CTCATGTCCT,160M3D162M,322,160M3D162M,160,161,-1,-3,-1,-3,-4,160,161,1,A,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,40,NA,NA,1,2.5,complex
4,AATTGGAAAA_CTCATGTCCT,117M1I208M,326,117M1I208M,121,208,-40,44,-40,0,-40,121,164,41,ATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,15,NA,NA,1,0,complex
5,AATTGGAAAA_CTCATGTCCT,157M2D166M,323,157M2D166M,157,166,-4,2,-4,0,-4,157,164,2,CC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTACCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,NA,NA,1,0,deletion
6,AATTGGAAAA_CTCATGTCCT,161M3D161M,322,161M3D161M,161,161,0,-3,0,-3,-3,161,161,0,,deletion,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,NA,0,1,0,deletion
RECONSTRUCTED_SEQ
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment