Commit b6e4236f authored by Rebecca E Batorsky's avatar Rebecca E Batorsky
Browse files

test

parent 5bf3930d
......@@ -13,7 +13,7 @@ args = commandArgs(trailingOnly=TRUE)
suppressPackageStartupMessages(library(tidyverse))
suppressPackageStartupMessages(library(Biostrings))
suppressPackageStartupMessages(library(stringr))
suppressPackageStartupMessages(library(Biostrings))
suppressPackageStartupMessages(library(dplyr))
##test if there is at least one argument: if not, return an error
if (length(args)<5) {
......@@ -31,8 +31,18 @@ if (length(args)<5) {
a<-read.csv(insertion_in)
## get reference
hifibr_input = read.csv(hifi_in)
hifibr_input = read.csv(hifi_in,header=T)
ref = hifibr_input %>% dplyr::filter(., CLASS_final == 'exact')
n_ref = nrow(ref)
if ( n_ref != 1){
print(paste0("ERROR: Found ", n_ref, " reference sequences in Hifibr output."))
quit(save = "no", status = 1, runLast = FALSE)
}
ref = ref$ALIGNED_SEQ
n <- search_radius # number of bases to the left and right of the break you want to search of repeated motifs
......
......@@ -44,6 +44,8 @@ ref = hifibr_input %>% dplyr::filter(., CLASS == 'exact')
ref_seq = ref$ALIGNED_SEQ
n_ref = nrow(ref)
print(n_ref)
if ( n_ref != 1){
print(paste0("ERROR: Found ", n_ref, " reference sequences in Hifibr output."))
quit(save = "no", status = 1, runLast = FALSE)
......@@ -198,5 +200,5 @@ write(insertions, file = paste0(out_dir,"/",out_string,"_insertion.txt"),append
write(comp_unknown, file = paste0(out_dir,"/", out_string,"_complex.txt"),append = FALSE, sep = "\n")
## output file
write.csv(hifibr_input, file = paste0(out_dir,"/", out_string,"_reclassified.csv"), row.names = FALSE)
write.csv(hifibr_input, file = paste0(out_dir,"/", out_string,"_reclassified.csv"), row.names = FALSE,quote=F)
......@@ -19,16 +19,12 @@ debug=0
bn=$( basename ${input%.csv} )
results_dir=$( pwd )/$( dirname $input )/${bn}_output
mkdir -p ${results_dir}
echo "Results will be located in ${results_dir}"
hifi_reclass=${results_dir}/${bn}_reclassified.csv
deletion_out=${results_dir}/${bn}_deletion.txt
insertion_out=${results_dir}/${bn}_insertion.txt
#source /anaconda3/etc/profile.d/conda.sh
#conda deactivate
#conda activate sdmmej
#cd ~/Documents/git/sdmmej
echo ${hifi_reclass}
echo "------"
echo "Starting to process HiFibr output file"
......@@ -39,10 +35,10 @@ Rscript process_hifibr.R $input $results_dir $search_radius $breakpoint $debug
echo "------"
echo "Done Hifiber processing"
echo "------"
echo "Starting deletion consistency script"
echo "Starting deletion consistency script, see log ${bn}_deletion.log"
cd deletion/
python SDMMEJDeletionProgram_cli.py -hi ${hifi_reclass} -del ${deletion_out} -n $breakpoint -out $results_dir
python SDMMEJDeletionProgram_cli.py -hi ${hifi_reclass} -del ${deletion_out} -n $breakpoint -out $results_dir > ${results_dir}/${bn}_deletion.log
echo "------"
echo "Done deletion script"
......@@ -58,3 +54,4 @@ echo "------"
echo "Done insertion script"
echo "------"
echo "Results will be located in ${results_dir}"
......@@ -4,4 +4,4 @@ AATTGGAAAA_CTCATGTCCT,325M,325,325M,150,164,-11,0,-11,0,-11,150,164,11,NCTGTTATC
AATTGGAAAA_CTCATGTCCT,160M3D162M,322,160M3D162M,160,161,-1,-3,-1,-3,-4,160,161,1,A,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,40,,NA,1,2.5
AATTGGAAAA_CTCATGTCCT,117M1I208M,326,117M1I208M,121,208,-40,44,-40,0,-40,121,164,41,ATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,15,,,1,0
AATTGGAAAA_CTCATGTCCT,157M2D166M,323,157M2D166M,157,166,-4,2,-4,0,-4,157,164,2,CC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTACCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,,NA,1,0
AATTGGAAAA_CTCATGTCCT,161M3D161M,322,161M3D161M,161,161,0,-3,0,-3,-3,161,161,0,,deletion,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,,0,1,0
\ No newline at end of file
AATTGGAAAA_CTCATGTCCT,161M3D161M,322,161M3D161M,161,161,0,-3,0,-3,-3,161,161,0,,deletion,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,,0,1,0
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC---AGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTA--CCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
Sample ID Deletion Length Repair Type Mechanism Motif to Break Motif to Deletion P1 to Break P1 to Deletion P2 to Break P2 to Deletion P1 to P2 Motif Length Break Side Deletion to MH Motif Sequence
1 3 ABJ snap-back 11 11 8 8 1 1 7 4 left -3 CCTG/CAGG
1 3 ABJ loop-out 17 14 17 14 8 5 9 6 right 0 CAGGCC/CAGGCC
2 2 ABJ loop-out 27 23 27 23 5 1 22 4 left 2 ACCT/ACCT
2 2 ABJ loop-out 15 11 15 11 7 3 8 5 left 2 TTACC/TTACC
RECONSTRUCTED_SEQ
GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC
ID,UMI,CIGAR_STRING,READ_LENGTH,SPLIT_CIGAR_STRING,MATCH_LEFT,MATCH_RIGHT,DISTANCE_FROM_BREAK_LEFT,DISTANCE_FROM_BREAK_RIGHT,DELETION_FROM_LEFT,DELETION_FROM_RIGHT,TOTAL_DELETION,INSERTION_START,INSERTION_END,INSERTION_LENGTH,INSERTED_SEQ,CLASS,ALIGNED_SEQ,READS,MICROHOMOLOGY,MH_Length,NUMBER_OF_ALIGNMENTS,MISMATCH_PERCENTAGE_TO_RECONSTRUCTED,CLASS_final
1,AATTGGAAAA_CTCATGTCCT,325M,325,325M,325,325,164,161,0,0,0,161,164,0,,exact,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,214208,NA,NA,1,1.847269943,exact
2,AATTGGAAAA_CTCATGTCCT,325M,325,325M,150,164,-11,0,-11,0,-11,150,164,11,NCTGTTATCCC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,24,NA,NA,1,8.333333333,insertion
3,AATTGGAAAA_CTCATGTCCT,160M3D162M,322,160M3D162M,160,161,-1,-3,-1,-3,-4,160,161,1,A,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCAAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,40,NA,NA,1,2.5,complex
4,AATTGGAAAA_CTCATGTCCT,117M1I208M,326,117M1I208M,121,208,-40,44,-40,0,-40,121,164,41,ATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,15,NA,NA,1,0,complex
5,AATTGGAAAA_CTCATGTCCT,157M2D166M,323,157M2D166M,157,166,-4,2,-4,0,-4,157,164,2,CC,complex,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTACCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,NA,NA,1,0,deletion
6,AATTGGAAAA_CTCATGTCCT,161M3D161M,322,161M3D161M,161,161,0,-3,0,-3,-3,161,161,0,,deletion,GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACCCTGTTATCCCAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC,10,NA,0,1,0,deletion
"","ID","insertion_alignment","mechanism"
"1","PolyA1Seq_testdata-1","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","seq"
"2","PolyA1Seq_testdata-1","0","Loop-out"
"3","PolyA1Seq_testdata-1","0","Snap-back"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","RECONSTRUCTED_SEQ","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","Loop-out","Snap-back"
"1","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"0","0"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","mechanism","insertion_alignment","unicorn"
"1","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"seq","GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","PolyA1Seq_testdata-1-seq-GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACNCTGTTATCCCTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC"
"2","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Loop-out","0","PolyA1Seq_testdata-1-Loop-out-0"
"3","PolyA1Seq_testdata-1",NA,NA,NA,NA,"FALSE",150,162,"GATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGATCCTAGGAGGGAAAAAATTCGTACTTTGGAGTACGAAAATTGGAAAATAGAGCAGCACTCACCTTATTGTCATTACTAGAGGCCAAACAGGCCGGCGCCTCCTAACGATCCTCTAGCTCATGTCCTGAACGTTAACGTTAACGTAACGTTAACTCGAGGCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACCCCAGGACC","NCTGTTATCCC","PolyA1Seq_testdata",NA,NA,"Snap-back","0","PolyA1Seq_testdata-1-Snap-back-0"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment