Commit dbcbea48 authored by Rebecca E Batorsky's avatar Rebecca E Batorsky
Browse files

removing files

parent 3e1cd766
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
"","ID","insertion_alignment","mechanism"
"1","test_data_m6-1","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"2","test_data_m6-1","---------------------------------------------------------------TTACCCTGTTAT--------------------------------------------------------------------------------------------------------","Loop-out"
"3","test_data_m6-1","0","Snap-back"
"4","test_data_m6-2","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"5","test_data_m6-2","---------------------------------------------------------------------TGTTAT-----------------------------------------------------------------------------------------------------","Loop-out"
"6","test_data_m6-2","------------------------------------------------------------acat----------------------------------------------------------------------------------------------------------------","Snap-back"
"7","test_data_m6-3","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"8","test_data_m6-3","0","Loop-out"
"9","test_data_m6-3","0","Snap-back"
"10","test_data_m6-4","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"11","test_data_m6-4","---------------------------------------------------------------------------------CTAT--------------------------------------------------------------------------------------","Loop-out"
"12","test_data_m6-4","0","Loop-out"
"13","test_data_m6-4","0","Snap-back"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","RECONSTRUCTED_SEQ","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","Loop-out","Snap-back"
"1","test_data_m6-1",64,75,NA,NA,"TRUE","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG",74,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCCTG","test_data_m6",12,NA,"---------------------------------------------------------------TTACCCTGTTAT--------------------------------------------------------------------------------------------------------","0"
"2","test_data_m6-2",70,75,61,64,"TRUE","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG",75,77,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","G","test_data_m6",6,4,"---------------------------------------------------------------------TGTTAT-----------------------------------------------------------------------------------------------------","------------------------------------------------------------acat----------------------------------------------------------------------------------------------------------------"
"3","test_data_m6-3",NA,NA,NA,NA,"FALSE","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG",75,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCTG","test_data_m6",NA,NA,"0","0"
"4","test_data_m6-4",81,84,NA,NA,"TRUE","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",4,NA,"---------------------------------------------------------------------------------CTAT--------------------------------------------------------------------------------------","0"
"5","test_data_m6-4",NA,74,NA,NA,"FALSE","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",3,NA,"0","0"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","mechanism","insertion_alignment","unicorn"
"1","test_data_m6-1",64,75,NA,NA,"TRUE",74,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCCTG","test_data_m6",12,NA,"seq","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","test_data_m6-1-seq-GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG"
"6","test_data_m6-1",64,75,NA,NA,"TRUE",74,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCCTG","test_data_m6",12,NA,"Loop-out","---------------------------------------------------------------TTACCCTGTTAT--------------------------------------------------------------------------------------------------------","test_data_m6-1-Loop-out----------------------------------------------------------------TTACCCTGTTAT--------------------------------------------------------------------------------------------------------"
"11","test_data_m6-1",64,75,NA,NA,"TRUE",74,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCCTG","test_data_m6",12,NA,"Snap-back","0","test_data_m6-1-Snap-back-0"
"2","test_data_m6-2",70,75,61,64,"TRUE",75,77,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","G","test_data_m6",6,4,"seq","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","test_data_m6-2-seq-GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG"
"7","test_data_m6-2",70,75,61,64,"TRUE",75,77,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","G","test_data_m6",6,4,"Loop-out","---------------------------------------------------------------------TGTTAT-----------------------------------------------------------------------------------------------------","test_data_m6-2-Loop-out----------------------------------------------------------------------TGTTAT-----------------------------------------------------------------------------------------------------"
"12","test_data_m6-2",70,75,61,64,"TRUE",75,77,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","G","test_data_m6",6,4,"Snap-back","------------------------------------------------------------acat----------------------------------------------------------------------------------------------------------------","test_data_m6-2-Snap-back-------------------------------------------------------------acat----------------------------------------------------------------------------------------------------------------"
"3","test_data_m6-3",NA,NA,NA,NA,"FALSE",75,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCTG","test_data_m6",NA,NA,"seq","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","test_data_m6-3-seq-GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG"
"8","test_data_m6-3",NA,NA,NA,NA,"FALSE",75,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCTG","test_data_m6",NA,NA,"Loop-out","0","test_data_m6-3-Loop-out-0"
"13","test_data_m6-3",NA,NA,NA,NA,"FALSE",75,80,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","CCTG","test_data_m6",NA,NA,"Snap-back","0","test_data_m6-3-Snap-back-0"
"4","test_data_m6-4",81,84,NA,NA,"TRUE",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",4,NA,"seq","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","test_data_m6-4-seq-GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG"
"9","test_data_m6-4",81,84,NA,NA,"TRUE",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",4,NA,"Loop-out","---------------------------------------------------------------------------------CTAT--------------------------------------------------------------------------------------","test_data_m6-4-Loop-out----------------------------------------------------------------------------------CTAT--------------------------------------------------------------------------------------"
"10","test_data_m6-4",NA,74,NA,NA,"FALSE",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",3,NA,"Loop-out","0","test_data_m6-4-Loop-out-0"
"14","test_data_m6-4",81,84,NA,NA,"TRUE",70,72,"GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","A","test_data_m6",4,NA,"Snap-back","0","test_data_m6-4-Snap-back-0"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment