Commit e4cb6166 authored by Rebecca E Batorsky's avatar Rebecca E Batorsky
Browse files

updated files

parent 7839f651
<?xml version="1.0" encoding="UTF-8"?>
<project version="4">
<component name="VcsDirectoryMappings">
<mapping directory="$PROJECT_DIR$/.." vcs="Git" />
</component>
</project>
\ No newline at end of file
This diff is collapsed.
This diff is collapsed.
......@@ -13,9 +13,9 @@ library(Biostrings)
##setwd("/Users/awelterofcollidingmaterials/desktop/")
##a<-read.csv("TestData_Insertions.csv")
a<-read.csv("~/Desktop/TestData_Insertions.csv")
setwd("/Users/rbator01/Documents/git/sdmmej/test_data/")
#a<-read.csv("~/Desktop/TestData_Insertions.csv")
a<-read.csv("/Users/rbator01/Documents/git/sdmmej/test_data/TestData_HiFiBR_Output_mod_output/TestData_HiFiBR_Output_mod_insertion.txt")
n <- 30 # number of bases to the left and right of the break you want to search of repeated motifs
p <- 10 # number of bases to the left and right of the initial repeat motif to search for homology
......
......@@ -5,10 +5,11 @@ suppressPackageStartupMessages(library(tidyverse))
suppressPackageStartupMessages(library(Biostrings))
# test if there is at least one argument: if not, return an error
if (length(args)==0) {
stop("Usage: Rscript process_hifibr.R input_file.csv", call.=FALSE)
} else if (length(args)==1) {
if (length(args)<2) {
stop("Usage: Rscript process_hifibr.R input_file.csv outdir", call.=FALSE)
} else if (length(args)==2) {
input_file = args[1]
out_dir = args[2]
}
#input_file="~/Documents/git/sdmmej/test_data/TestData_HiFiBR_Output_mod.csv"
......@@ -115,14 +116,17 @@ for (row in 1:nrow(hifibr_input_filter_complex)){
}
## write out
dir.create(out_dir,showWarnings = FALSE)
## deletions
write(aligned_deletions, file = paste0("~/Documents/git/sdmmej/test_data/output/",out_string,"_deletion.txt"),append = FALSE, sep = "\n")
write(aligned_deletions, file = paste0(out_dir,"/", out_string,"_deletion.txt"),append = FALSE, sep = "\n")
## insertions
write(insertions, file = paste0("~/Documents/git/sdmmej/test_data/output/",out_string,"_insertion.txt"),append = FALSE, sep = "\n")
insertions = c("RECONSTRUCTED_SEQ",insertions)
write(insertions, file = paste0(out_dir,"/",out_string,"_insertion.txt"),append = FALSE, sep = "\n")
## unknown complex
write(comp_unknown, file = paste0("~/Documents/git/sdmmej/test_data//output/",out_string,"_complex.txt"),append = FALSE, sep = "\n")
write(comp_unknown, file = paste0(out_dir,"/", out_string,"_complex.txt"),append = FALSE, sep = "\n")
## output file
write.csv(hifibr_input, file = paste0("~/Documents/git/sdmmej/test_data/output/",out_string,"_reclassified.csv"), row.names = FALSE)
write.csv(hifibr_input, file = paste0(out_dir,"/", out_string,"_reclassified.csv"), row.names = FALSE)
#!/bin/bash
## takes one argument which is the hifi output
input=$1
nick=$2
DIR="$( cd "$( dirname "${BASH_SOURCE[0]}" )" >/dev/null 2>&1 && pwd )"
bn=$( basename ${input%.csv} )
results_dir=${DIR}/$( dirname $input )/${bn}_output
mkdir -p ${results_dir}
echo ${results_dir}
hifi_reclass=${results_dir}/${bn}_reclassified.csv
deletion_out=${results_dir}/${bn}_deletion.txt
insertion_out=${results_dir}/${bn}_insertion.txt
echo "------"
echo "Starting Hifibr processing"
#Rscript process_hifibr.R $input $results_dir
echo "Done Hifiber processin"
echo "------"
echo "Starting deletion consistency script"
#python ${DIR}/deletion/SDMMEJDeletionProgram_cli.py -hi ${hifi_reclass} -del ${deletion_out} -n ${nick} -out $results_dir
echo "Done deletion script"
echo "------"
echo "Starting insertion consistency script"
Rscript insertion/INSERTION_PROGRAM.R ${hifi_reclass} ${insertion_out} ${nick} ${results_dir}
echo "Done insertion script"
echo "------"
No preview for this file type
======================== RESULTS (A): ============================
========= SUMMARY OF INPUT DATA AND ANALYSIS PARAMETERS ==========
4 junction sequences successfully read from file
1: GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT----------GGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
2: GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACAT-----------CCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
3: GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATC------------------------------TGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
4: GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCT--TATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
* # bases to search left/right of junction for SD-MMEJ consistent repeats: 30
* Minimum SD-MMEJ consistent repeat size: 4
----------end summary of input data and analysis parameters--------
======================== RESULTS (B): ============================
=============== ALIGNMENT OF INPUT DATA SEQUENCES ================
* 4 total junctions (0 ABJs, 4 MHJs)
* Overhangs in original sequence in lowercase in tables below.
* Ambiguous bases at MHJs have been assigned to the left.
--Apparent Blunt Joins--
deln deln
lowercase in original sequence indicates overhangs bounds size
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
--Microhomology Joins--
deln deln mh mh indices
lowercase in original sequence indicates overhangs bounds size len in original seq
--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTAT----------GGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (75, 85) 10 3 ((72, 75), (82, 85))
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACAT-----------CCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (64, 75) 11 2 ((62, 64), (73, 75))
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATC------------------------------TGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (76, 106) 30 3 ((73, 76), (103, 106))
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCT--TATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (70, 72) 2 1 ((69, 70), (71, 72))
----------end alignment of input data sequences--------
======================== RESULTS (C): ============================
=============== DELETION BOUNDARY FREQUENCY DATA =================
* Deletion boundaries are defined as the first base remaining to
the left of the right-hand nick and the first base remaining to
the right of the left-hand nick.
* A consequence of this definition of deletion boundary is that
values in the _del right_ and _del left_ columns in the tables below
will NOT necessarily correspond to the net number of bases deleted.
See documentation for more detail as to why.
* Deletion boundaries for microhomology junctions are calculated
with the ambiguous bases assigned to the left of the junction.
Deletion Boundary Frequencies
first base remaining to RIGHT of LEFT nick:
---------------
del
right base freq
---------------
0 T 0
1 T 1
2 A 0
3 T 0
4 C 1
5 C 0
6 C 0
7 T 0
8 A 0
9 G 0
10 C 0
11 T 0
12 A 0
13 T 0
14 G 1
15 G 0
16 T 0
17 C 0
18 T 0
19 G 0
20 C 0
21 G 0
22 C 0
23 T 0
24 A 0
25 C 0
26 T 0
27 A 0
28 G 0
29 T 0
30 G 0
31 G 0
32 A 0
33 T 0
34 C 0
35 T 1
36 G 0
37 G 0
38 G 0
39 G 0
40 C 0
41 C 0
42 G 0
43 C 0
44 A 0
45 T 0
46 A 0
47 G 0
48 G 0
49 C 0
50 C 0
51 A 0
52 T 0
53 C 0
54 C 0
55 T 0
56 C 0
57 T 0
58 A 0
59 G 0
60 A 0
61 G 0
62 T 0
63 C 0
64 G 0
65 A 0
66 C 0
67 C 0
68 T 0
69 C 0
70 G 0
71 A 0
72 A 0
73 C 0
74 G 0
75 T 0
76 A 0
77 A 0
78 A 0
79 C 0
80 G 0
81 T 0
82 T 0
83 A 0
84 A 0
85 C 0
86 G 0
87 T 0
88 A 0
89 A 0
90 C 0
91 G 0
92 T 0
93 T 0
94 A 0
95 A 0
96 C 0
97 T 0
98 C 0
99 G 0
---------------
Deletion Boundary Frequencies
first base remaining to LEFT of RIGHT nick:
---------------
del
left base freq
---------------
0 T 1
1 A 0
2 T 0
3 T 0
4 G 0
5 T 1
6 C 0
7 C 0
8 C 0
9 A 0
10 T 0
11 T 1
12 A 0
13 C 0
14 A 0
15 T 0
16 G 0
17 G 0
18 C 0
19 T 0
20 T 0
21 A 0
22 A 0
23 G 0
24 C 0
25 C 0
26 G 0
27 A 0
28 C 0
29 G 0
30 A 0
31 C 0
32 G 0
33 A 0
34 G 0
35 A 0
36 T 0
37 T 0
38 T 0
39 G 0
40 C 0
41 T 0
42 G 0
43 C 0
44 G 0
45 T 0
46 A 0
47 A 0
48 A 0
49 G 0
50 C 0
51 A 0
52 T 0
53 G 0
54 A 0
55 G 0
56 G 0
57 T 0
58 T 0
59 T 0
60 C 0
61 A 0
62 T 0
63 G 0
64 C 0
65 T 0
66 T 0
67 A 0
68 A 0
69 A 0
70 A 0
71 A 0
72 A 0
73 G 0
74 G 0
---------------
======================== RESULTS (D): ============================
============= APPARENT BLUNT JOIN SD-MMEJ ANALYSIS ===============
----------- ABJ SUMMARY ----------
search radius = 30
min consistent rep length = 4
0 total ABJs
0 SD-MMEJ consistent ABJs
----------------------------------
-------------- SEQUENCES OF SD-MMEJ CONSISTENT ABJs --------------
Apparent point of ligation shown as upper/lowercase transition
------------------------------------------------------------------
deln deln
repair junction sequence size indices
------------------------------------------------------------------
------------------------------------------------------------------
----------- SEQUENCES OF *NON* SD-MMEJ CONSISTENT ABJs -----------
Apparent point of ligation shown as upper/lowercase transition
------------------------------------------------------------------
deln deln
repair junction sequence size indices
------------------------------------------------------------------
------------------------------------------------------------------
-------- ALIGNMENTS OF SD-MMEJ CONSISTENT ABJs ---------
--------------------------------------------------------
------ ALIGNMENTS OF *NON* SD-MMEJ CONSISTENT ABJs --------
-----------------------------------------------------------
----------end SD-MMEJ analysis of apparent blunt joins---------------
********************** RESULTS (E): ****************************
********** MICROHOMOLOGY JUNCTION SD-MMEJ ANALYSIS *************
-------- MHJ SUMMARY ----------
search radius = 30
min consistent rep length = 4
4 total MHJs
2 SD-MMEJ consistent MHJs
-------------------------------
-------------- SEQUENCES OF SD-MMEJ CONSISTENT MHJs --------------
Ambiguous bases in repair product in lowercase
------------------------------------------------------------------
deln deln
sequence size indices
------------------------------------------------------------------
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG 11 (64, 75)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCtTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG 2 (70, 72)
------------------------------------------------------------------
----------- SEQUENCES OF *NON* SD-MMEJ CONSISTENT MHJs -----------
Ambiguous bases in repair product in lowercase
------------------------------------------------------------------
deln deln
sequence size indices
------------------------------------------------------------------
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTtatGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG 10 (75, 85)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTatcTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG 30 (76, 106)
------------------------------------------------------------------
======== ALIGNMENTS OF SD-MMEJ CONSISTENT MHJs =========
========================================================
** consistent MHJ 1 of 2 **
deletion size: 11
deletion indices: (64, 75)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (original sequence)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACAT-----------CCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
search radius = 30
min consistent rep length = 4
1 total SD-MMEJ consistent repeats:
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG repeated motif length: 4
--------------------------------------------------------------atCC----------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------GGAT------------------------------------------------------------------
------------------------------------------------------------------
** consistent MHJ 2 of 2 **
deletion size: 2
deletion indices: (70, 72)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG (original sequence)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCT--TATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
search radius = 30
min consistent rep length = 4
1 total SD-MMEJ consistent repeats:
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCtTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG repeated motif length: 4
------------------------------------------------------------------CCCt---------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------CCCT--------------------------------------------------------------------------------------------
------------------------------------------------------------------
------ ALIGNMENTS OF *NON* SD-MMEJ CONSISTENT MHJs --------
-----------------------------------------------------------
** NON-consistent MHJ 1 of 2 **
deletion size:10
deletion indices: (75, 85)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG(original sequence)
search radius = 30
min consistent rep length = 4
0 total SD-MMEJ consistent repeats
---------------------------------------------------------------------
** NON-consistent MHJ 2 of 2 **
deletion size:30
deletion indices: (76, 106)
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGttatCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG(original sequence)
search radius = 30
min consistent rep length = 4
0 total SD-MMEJ consistent repeats
---------------------------------------------------------------------
----------end SD-MMEJ analysis of microhomology joins---------------
******************************************
Analysis complete!
\ No newline at end of file
Sample ID Deletion Length Repair Type Mechanism Motif to Break Motif to Deletion P1 to Break P1 to Deletion P2 to Break P2 to Deletion P1 to P2 Motif Length Break Side Deletion to MH Motif Sequence
2 11 MHJ snap-back 34 32 34 32 6 4 28 4 right -7 ATCC/GGAT
4 2 MHJ loop-out 8 11 8 11 1 4 7 4 right -1 CCCT/CCCT
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
RECONSTRUCTED_SEQ
RECONSTRUCTED_SEQ
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG
......
"","ID","insertion_alignment","mechanism"
"1","TestData_HiFiBR_Output_mod-1","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"2","TestData_HiFiBR_Output_mod-1","0","Loop-out"
"3","TestData_HiFiBR_Output_mod-1","0","Snap-back"
"4","TestData_HiFiBR_Output_mod-2","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTATCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"5","TestData_HiFiBR_Output_mod-2","0","Loop-out"
"6","TestData_HiFiBR_Output_mod-2","0","Snap-back"
"7","TestData_HiFiBR_Output_mod-3","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTGTTACCCTGTTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"8","TestData_HiFiBR_Output_mod-3","0","Loop-out"
"9","TestData_HiFiBR_Output_mod-3","0","Snap-back"
"10","TestData_HiFiBR_Output_mod-4","GGAAAAAATTCGTACTTTGGAGTACGAAATGCGTCGTTTAGAGCAGCAGCCGAATTCGGTACATTACCCTATTATCCCTAGCTATGGTCTGCGCTACTAGTGGATCTGGGGCCGCATAGGCCATCCTCTAGAGTCGACCTCGAACGTAAACGTTAACGTAACGTTAACTCG","seq"
"11","TestData_HiFiBR_Output_mod-4","---------------------------------------------------------------------------------CTAT--------------------------------------------------------------------------------------","Loop-out"
"12","TestData_HiFiBR_Output_mod-4","0","Loop-out"
"13","TestData_HiFiBR_Output_mod-4","0","Snap-back"
"","ID","DR_START","DR_END","RC_START","RC_END","consistency","RECONSTRUCTED_SEQ","left_del","right_del","del_seq","insertion","plasmid","DRmotif_length","RCmotif_length","Loop-out","Snap-back"